microCache^TM Small RNA Cloning Products

454 Adapter Primer Sets

454 Adaptor Primers are designed to convert small RNA libraries created by the miRCat™ Kit (Set I) or by the miRCat-33™ Kit (Set II) into 454-compatible PCR libraries for deep sequencing⁴.

Set I:
FOR: 5′- GCCTCCCTCGCGCCATCAGTGGAATTCTCGGGCACC -3′
REV: 5′- GCCTTGCCAGCCCGCTCAGGATTGATGGTGCCTACAG -3′

Set II:
FOR: 5′- GCCTCCCTCGCGCCATCAGGATTGATGGTGCCTACAG -3′
REV: 5′- GCCTTGCCAGCCCGCTCAGCCTTGGCACCCGAGAATT -3′

 
5′ M.R.S (Multiple Restriction Site) miRNA Cloning Linker

The 5′ M.R.S Linker sequence is designed for use with any of the 3′ miRNA cloning linkers. The sequence has been optimized for linking to the 5′ end of RNAs containing a 5′ phosphate group. The reaction is carried out with T4 RNA Ligase in the presence of 1 mM ATP. The sequence contains restriction endonuclease recognition sites compatible with Ban 1 (Linker 1), Sty I and Ava I (Linker 2) and EcoRI (Linker 3). Upon reverse transcription of doubly-linked RNAs, the restriction endonuclease appropriate for the 3′ cloning linker will also generate compatible ends in the 5′ M.R.S Linker sequence permitting concatamerization and/or cloning. Further, the additional restriction sites in the M.R.S Linker, when matched with specific 3′ linkers can generate ends for directional cloning. For example, M.R.S Linker/Linker 3 digestion with EcoRI and Ban I will leave a Ban I 5′ end and an EcoRI 3′ end.

miRCat-33^TM Conversion Oligos

miRCat-33^TM is a conversion of the miRCat^TM kit for the purpose of performing 5′ ligation-independent small RNA cloning using the method of Pak and Fire².

Contents:

• miRCat-33™ 3′ pre-activated, adenylated cloning linker
  Sequence- 5′- rAppTGGAATTCTCGGGTGCCAAGG/ddC/ -3′
• miRCat-33™ PCR Primer
  Sequence- 5′- CCTTGGCACCCGAGAATT -3′

Primer is included at no charge.

3′ Cloning Linkers

Linker-1 is the original modban sequence employed by Lau and Bartel in 2001¹ and contains a Ban-I restriction site. Linker-2 contains Ava-I and Sty-I restriction sites. Linker-3 contains EcoRI and Msp-I restriction sites and was adapted from Pfeffer and Tuschl³. All three linkers are modified with a 3′-terminal dideoxy-C (ddC) base to prevent self ligation. Experiments have shown miRNA linker performance can vary depending on the RNA source. For this reason, the miRNA Cloning Linker Pack provides small samples (1 nmole) of each of the three linkers and is useful for optimizing methods before using precious RNA samples in large-scale library construction.

Linker oligonucleotides are provided lyophilized and are ready for use in cloning; just resuspend at the desired concentration and add to your ligation mix (using T4 RNA Ligase without ATP). Use of this reagent can improve cloning efficiency of miRNAs, which have a 5′-phosphate and will circularize if attachment of linkers is attempted using RNA Ligase in the presence of ATP.

Specifications

miSPIKE^TM 21-mer Internal RNA Control

miSPIKE^TM is a synthetic 21-mer RNA sequence specifically selected not to target any known small RNA sequence in GenBank, miRBase, or RNAdb, and was synthesized without a 5′ phosphate. This was done so that the marker can serve both as a size marker for small RNA enrichment on a denaturing acrylamide gel and as a 3′ ligation control, but will be unable to participate in 5′ ligations.

Sequence: 5′- rCrUrCrArGrGrArUrGrGrCrGrGrArGrCrGrGrUrCrU -3′

piSPIKE^TM 31-mer Internal RNA Control

piSPIKE^TM is a synthetic 31-mer RNA whose sequence was specifically selected not to target any known small RNA sequence in GenBank, miRBase, or RNAdb, and was synthesized without a 5′ phosphate. This was done so that the marker can serve both as a size marker for small RNA enrichment on a denaturing acrylamide gel and as a 3′ ligation control, but will be unable to participate in 5′ ligations.

Sequence: 5′- rCrUrCrArGrGrArUrGrGrCrGrGrArGrCrGrGrUrCrUrCrArCrUrGrArArCrGrU -3′

 Place an Order Now

References

1. Lau NC, Lim LP, Weinstein EG, and Bartel DP 2001 An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294:858-862.

2. Pak J and Fire A 2007 Distinct populations of primary and secondary effectors during RNAi in C. elegans. Science 315: 241-244.

3. Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyke LF, Ho CK, Shuman S, Chien M, et. al. 2005 Identification of microRNAs of the herpesvirus family. Nature Methods 2: 269-276.

4. Margulies M, Egholm M, Altman WE, Attiya S, Bader JS, Bemben LA, Berka J, Braverman MS, Chen Y-J, Dewell SB et al. 2005 Genome sequencing in microfabricated high-density picolitre reactors. Nature 437: 376-380.